View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16559_low_2 (Length: 359)
Name: NF16559_low_2
Description: NF16559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16559_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 350
Target Start/End: Complemental strand, 43260150 - 43259785
Alignment:
| Q |
7 |
acatttatagtaagtgatgtgtatgatattaattagatgatataattggaatnnnnnnnnnn-tcattgaaaactagaaacaacatttatttttggacaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43260150 |
acatttatagtaagtgatgtgtatgatattaattagatgatataattggaataaaataaaaaatcattgaaaactagaaacaacatttatttttggacaa |
43260051 |
T |
|
| Q |
106 |
attattttatctaaagagtag-------------------cgcaagattgtatctatttaatcttgacattttgtaatgaatgaactttaatcttacgat |
186 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||| |
|
|
| T |
43260050 |
attattttatctaaagagtagatacaacatttaattatagcgcaagattgtatctatttaatcttgatattttgcaatgagtgaactttaatcttacgat |
43259951 |
T |
|
| Q |
187 |
ctttaagaagccattgccttcgtaaatctgtcaaattggaattgtgagttgaaacatatttattaggaggataatttatgcgatcttcttgcaaacctag |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
43259950 |
ctttaagaagccattgccttcgtaaatctgtcaaattggaattgtgagttgaaacatatttattaggaggataatctatgcgatcttcttgcaaacttag |
43259851 |
T |
|
| Q |
287 |
gtcgtagtggatgagatattgaattattacaa--ttcactttcgtaaattttacttcttgatgatg |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43259850 |
gtcgtagtggatgagatattgaattattacaattttcactttcgtaaattttacttcttgatgatg |
43259785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University