View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16559_low_4 (Length: 264)
Name: NF16559_low_4
Description: NF16559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16559_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 28209835 - 28209604
Alignment:
| Q |
17 |
catgacaaagttacaagtggattctagctcacaaaaaatggatgcaataataaatttgggtttaagattctcaaacaagaatgaagagttaaaacttttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28209835 |
catgacaaagttacaagtggattctagctcacaaaaaatggatgcaataataaatctgggtttaagattctcaaacaagaatgaagagttaaaacttttg |
28209736 |
T |
 |
| Q |
117 |
tatggtcctctttttgtagaggtaatcagtaatgatgtcttattaggtaggactaaagttaaaggattctctcaagtgcctaaaaatgacacaaatttgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28209735 |
tatggtcctctttttgtagaggtaatcagtaatgatgtcttattaggtaggactaaagttaaaggattctctcaggtgcctaaaaatgacacaaatttgg |
28209636 |
T |
 |
| Q |
217 |
atatgacaatgacaacaaatgatgaaaatgtt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28209635 |
atatgacaatgacaacaaatgatgaaaatgtt |
28209604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University