View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1655_high_10 (Length: 245)
Name: NF1655_high_10
Description: NF1655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1655_high_10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 3 - 245
Target Start/End: Original strand, 14977107 - 14977349
Alignment:
| Q |
3 |
ccaacaatatatatggtactactataaatacatatctttaatcataatttctttctaaatctttaattcggtttttctcaactaggagagtttcagttgc |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14977107 |
ccaaaaatatatatggtactactataaatacatatctttaatcataatttctttctaaatctttaattcggtttttctcaactaggagagtttcagttgc |
14977206 |
T |
 |
| Q |
103 |
agcaattgggtgatcatcatcaaaacaaaaaccttaaattctttgttccagaaaacnnnnnnnnncatggttctttgaaacttcaaaaacctcgcatgtt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14977207 |
agcaattgggtgatcatcatcaaaacaaaaaccttaaattcttggttccagaaaacaaaaaaaaacatggttctttgaaacttcaaaaacctcgcatgtt |
14977306 |
T |
 |
| Q |
203 |
atggatctagaaggtggaactcgtcgaaatttttcaaaggtaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14977307 |
atggatctagaaggtggaactcgtcgaaattcttcaaaggtaa |
14977349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University