View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1655_low_16 (Length: 207)

Name: NF1655_low_16
Description: NF1655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1655_low_16
NF1655_low_16
[»] chr5 (1 HSPs)
chr5 (2-192)||(14977486-14977676)
[»] chr6 (1 HSPs)
chr6 (41-178)||(1807871-1808008)
[»] chr2 (1 HSPs)
chr2 (37-75)||(15385910-15385948)
[»] chr3 (1 HSPs)
chr3 (44-156)||(42988415-42988527)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 2 - 192
Target Start/End: Original strand, 14977486 - 14977676
Alignment:
2 tttttgcagaaagattcatggagaacagttctaacactagcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgttta 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14977486 tttttgcagaaagattcatggagaacagttctaacactagcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgttta 14977585  T
102 gaagtacttttggtgaaggaattggacactcaaatacaaatgaagagatttatggtgttttgtctttggtgttttggtctgttacattagt 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
14977586 gaagtacttttggtgaaggaattggacactcaaatacaaatgaagagatttatggtgttttgtctctggtgttttggtctgttacattagt 14977676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 178
Target Start/End: Original strand, 1807871 - 1808008
Alignment:
41 gcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagtacttttggtgaaggaattggacactcaaatacaa 140  Q
    |||||||||||| | ||||| || |||||||||||||||| ||| ||  ||||||| |  | ||| ||||||| ||| |  |||| ||| ||| ||||||    
1807871 gcatatcaaagtttaggagttgtgtatggagatttaagcacttctccactatatgtatacaaaagcacttttgctgaggatattgaacattcagatacaa 1807970  T
141 atgaagagatttatggtgttttgtctttggtgttttgg 178  Q
    ||||||| || | |||||| |||||||| |||||||||    
1807971 atgaagaaatctttggtgtattgtcttttgtgttttgg 1808008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 75
Target Start/End: Original strand, 15385910 - 15385948
Alignment:
37 actagcatatcaaagtcttggagtagtttatggagattt 75  Q
    ||||||||||||||||||||| |||||||| ||||||||    
15385910 actagcatatcaaagtcttggtgtagtttacggagattt 15385948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 156
Target Start/End: Complemental strand, 42988527 - 42988415
Alignment:
44 tatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagtacttttggtgaaggaattggacactcaaatacaaatg 143  Q
    |||||||||||||| || || |||||||| || || ||||| || || ||||| || | ||| ||||||| |||||  |||| ||| ||| | || ||||    
42988527 tatcaaagtcttggtgttgtatatggagacttgagtatttctccattgtatgttttcacaagcacttttgctgaagatattgaacattcagagactaatg 42988428  T
144 aagagatttatgg 156  Q
    |||||||||||||    
42988427 aagagatttatgg 42988415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University