View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1655_low_9 (Length: 268)
Name: NF1655_low_9
Description: NF1655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1655_low_9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 16 - 268
Target Start/End: Original strand, 34856723 - 34856975
Alignment:
| Q |
16 |
aatatagaatgcagtattacaatcaaaaaatactccaccgtgccagattcccaatcagaaacttgtaggataatttataactggaatgctaatcccacct |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34856723 |
aatatagaatgcagtattacaatcaataaatactccaccgtgccagattcccaatcagaaacttgtaggataatttataactggaatgctaatcccacct |
34856822 |
T |
|
| Q |
116 |
tagaattgctttggaatctagtaaacattgtcaccatgtctgagtctatacatcaactgctactagaaccaacaacaacctaaatggtgtaaaacaaaga |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34856823 |
tagaattgctttggaagctagtaaacattgtcaccatgtctgagtctatacatcaactgctactagaaccaacaacaacctaaatggtgtaaaacaaaga |
34856922 |
T |
|
| Q |
216 |
tttagctaccaacaataaggcaaattccattttatgcctttgtgtttaacatc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34856923 |
tttagctaccaacaataaggcaaattccattttatgcctttgtgtttaacatc |
34856975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University