View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16560_low_16 (Length: 236)
Name: NF16560_low_16
Description: NF16560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16560_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 36516725 - 36516521
Alignment:
| Q |
17 |
atactaaaactcaccccactcaagtgcatctcaccccccactttcccacagcacgtgaccttcagcatacactgcaccattcccattaccgtaccatata |
116 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36516725 |
atactaaaactcaccccagtcacgtgcatctcacccccaactttcccacagcacgtgaccttcaccatacactgcaccattcccattaccgtaccatata |
36516626 |
T |
|
| Q |
117 |
aaacctctaactcccccgtaagccaatgtcttctaactgttaccggtaaccggcttgacaagttaaccgaacgcttacgtgttggttcaataataatcca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36516625 |
aaacctctaactcccccgtaagccaatgtcttctaactgttaccggtaaccggcttgacaagttaaccgaacgcttacgtgtcggttcaataataatcca |
36516526 |
T |
|
| Q |
217 |
actaa |
221 |
Q |
| |
|
||||| |
|
|
| T |
36516525 |
actaa |
36516521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University