View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_102 (Length: 278)
Name: NF16561_high_102
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_102 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 109 - 147
Target Start/End: Complemental strand, 17030070 - 17030032
Alignment:
| Q |
109 |
tacaataaattaaataaatgaacttatgaaacaataaaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17030070 |
tacaataaattaaataaatgaacttatgaaacaataaaa |
17030032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 32 - 109
Target Start/End: Complemental strand, 17030332 - 17030255
Alignment:
| Q |
32 |
ataaatagttttacctacgaccgtataagtaaccggaaataatatgctttatctgaaactttttcttatcatattttt |
109 |
Q |
| |
|
|||||| |||||| ||||| |||||| ||||| || |||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
17030332 |
ataaattgttttaactacggccgtattagtaattggtcataatatgctttatatgcaactttttcttatcatattttt |
17030255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 163
Target Start/End: Complemental strand, 4858795 - 4858741
Alignment:
| Q |
109 |
tacaataaattaaataaatgaacttatgaaacaataaaattaaccttcaattata |
163 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| || |||| |||||| |
|
|
| T |
4858795 |
tacaataaattaaataaaataatttatgaaacaataaaataaaacttctattata |
4858741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University