View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_103 (Length: 276)
Name: NF16561_high_103
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_103 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 14 - 260
Target Start/End: Original strand, 635866 - 636114
Alignment:
| Q |
14 |
gaacaacatcctaaattgtttaagttgacattttgatcataaagtgaccaatagactgcaataaccaattagaacatgcttctttcaatttttctatgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
635866 |
gaacaacatcctaaattgtttaagttgacattttgatcatgaagtgaccaatagactacaataaccaattagaacatgcttctttcaatttttctatgaa |
635965 |
T |
 |
| Q |
114 |
gcacatgttgcctcttcctttactgtcattaatatgtaatagagatcagtcaaatttcgtgaagttcag--nnnnnnnnnnnnnnnnctgcataattact |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
635966 |
gcacatgttgcctcttcctttactgtcatcaatatgtaatagagatcagtcaaatttcgtgaagttcagaaaaaacgaaaaaaaaaactgcataattact |
636065 |
T |
 |
| Q |
212 |
tttttgtctctatcttcctactaagatgttaaattagtagtgttgcagc |
260 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
636066 |
tttttgtctctatcttcctactaggatgttaaattagtagtgttgcagc |
636114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University