View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_110 (Length: 259)
Name: NF16561_high_110
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_110 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 16330263 - 16330036
Alignment:
| Q |
11 |
gtgagatgaagtatccataaaatcttcatgctaaagttgtcgatttggagaaggttcctaagaaaaatcaaatggctctaaaggcatatgagaaagctct |
110 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
16330263 |
gtgagatgaagtatccataaactcttcatgctaaagttgtcgacttggagaaggttactaagaaaa-tcaaatggctctaatggcatctgagaaagctct |
16330165 |
T |
|
| Q |
111 |
ggatgaaaccatgttggctcataagaatgtggaggacctatatgctagtatagtgaagaaatatgaggattgccttaaggagtagaggtctataatggcg |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||| ||||| |||||||||||| ||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
16330164 |
ggatgaaaccatgctggctcataagaatgcggaggacctctatgccagtatagtgaaggaatatgaggattgcctt-aggaatagaggtctataatggcg |
16330066 |
T |
|
| Q |
211 |
agtccttaaagaatgcttcagagcaggtgg |
240 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
16330065 |
agtccttaaagaatgcttcggagcaggtgg |
16330036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University