View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16561_high_110 (Length: 259)

Name: NF16561_high_110
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16561_high_110
NF16561_high_110
[»] chr1 (1 HSPs)
chr1 (11-240)||(16330036-16330263)


Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 16330263 - 16330036
Alignment:
11 gtgagatgaagtatccataaaatcttcatgctaaagttgtcgatttggagaaggttcctaagaaaaatcaaatggctctaaaggcatatgagaaagctct 110  Q
    ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| ||||| ||||||||||||    
16330263 gtgagatgaagtatccataaactcttcatgctaaagttgtcgacttggagaaggttactaagaaaa-tcaaatggctctaatggcatctgagaaagctct 16330165  T
111 ggatgaaaccatgttggctcataagaatgtggaggacctatatgctagtatagtgaagaaatatgaggattgccttaaggagtagaggtctataatggcg 210  Q
    ||||||||||||| ||||||||||||||| ||||||||| ||||| |||||||||||| ||||||||||||||||| |||| ||||||||||||||||||    
16330164 ggatgaaaccatgctggctcataagaatgcggaggacctctatgccagtatagtgaaggaatatgaggattgcctt-aggaatagaggtctataatggcg 16330066  T
211 agtccttaaagaatgcttcagagcaggtgg 240  Q
    ||||||||||||||||||| ||||||||||    
16330065 agtccttaaagaatgcttcggagcaggtgg 16330036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University