View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_119 (Length: 253)
Name: NF16561_high_119
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_119 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 97 - 230
Target Start/End: Original strand, 31845737 - 31845867
Alignment:
| Q |
97 |
ccactcgaatcccaacttttgtgggaatctaacaaactagagaattgatctagttagattcatctaacaactgatattttgttagaggtaataaggctaa |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31845737 |
ccactcaaatcccaacttttgtgggaatctaacaaactagagtatcgatctagttagattcatctaacaactgatattttgttagagttaataaggctag |
31845836 |
T |
|
| Q |
197 |
tccttattattgagttattagtatcatatccaat |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
31845837 |
tccttattattgag---ttagtatcatatccaat |
31845867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 31845676 - 31845768
Alignment:
| Q |
1 |
tatattctcagtgatgtgtcttaaaatgtttattgagcaggacatgatccctacatccgttccactcaaatcccaactcatgtgggaatctaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
31845676 |
tatattctcagtgatgtgtcttaaaatgtttattgagcaggacatgatccctacatccgtcccactcaaatcccaacttttgtgggaatctaa |
31845768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University