View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_120 (Length: 253)
Name: NF16561_high_120
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_120 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 28 - 253
Target Start/End: Complemental strand, 38189603 - 38189378
Alignment:
| Q |
28 |
cttgtagtgtccggtgaatgtgaagttgcttttaccccttagggtttcatggatttaaaactctctgtataattgtttagcgagttgcttttgcctcttt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38189603 |
cttgtagtgtccggtgaatgtgaagttgcttttgccccttagggtttcatggatttaaaactctctgtataattgtttagcgagttgcttttgcctcttt |
38189504 |
T |
|
| Q |
128 |
gtaatttaaattttaatttgattatgtacttttcaattcgccttatgccttagttagacggtttgtgcatgtttattaaatttttatggtggtggattgc |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38189503 |
gtaatttaaatttaaatttgattatgtacttttcaattcgccttatgccttagttagacggtttgtgcatgtttattaaatttttatggtggtggattgc |
38189404 |
T |
|
| Q |
228 |
agcgacattcaagtccagggaggatc |
253 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
38189403 |
agcgacattcaggtccagggaggatc |
38189378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University