View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_148 (Length: 225)
Name: NF16561_high_148
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_148 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 72 - 177
Target Start/End: Complemental strand, 7488416 - 7488311
Alignment:
| Q |
72 |
aacatgtctgatagccatagtctcatgattctttataaaacaataccctatgtaacccttctctcatgtgacaacgtaacacacatcaaacccttctttt |
171 |
Q |
| |
|
|||||||||||||| | || ||||||||| ||| || |||||| |||||||||||| |||||||||||| ||| ||||| |||||||||| || |||||| |
|
|
| T |
7488416 |
aacatgtctgatagtcctaatctcatgatccttcatgaaacaaaaccctatgtaactcttctctcatgtcacaccgtaatacacatcaaatccctctttt |
7488317 |
T |
 |
| Q |
172 |
ccaaca |
177 |
Q |
| |
|
|||||| |
|
|
| T |
7488316 |
ccaaca |
7488311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 73
Target Start/End: Complemental strand, 7499757 - 7499702
Alignment:
| Q |
18 |
aatacatggctggctttagaatgatgtctcagttttttatgtttcttgatcatgaa |
73 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7499757 |
aatacatggctggttttagaatgatgtctcagttttttatgtttctagatcatgaa |
7499702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 6943675 - 6943733
Alignment:
| Q |
120 |
tatgtaacccttctctcatgtgacaacgtaacacacatcaaacccttcttttccaacaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||| || |||||||||||| |
|
|
| T |
6943675 |
tatgtaacccttctctcatgtgacaacctaatacacatcaaatcccccttttccaacaa |
6943733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 70
Target Start/End: Original strand, 8139168 - 8139198
Alignment:
| Q |
40 |
gatgtctcagttttttatgtttcttgatcat |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8139168 |
gatgtctcagttttttatgtttcttgatcat |
8139198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University