View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16561_high_149 (Length: 220)

Name: NF16561_high_149
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16561_high_149
NF16561_high_149
[»] chr1 (1 HSPs)
chr1 (18-204)||(46260548-46260734)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 46260548 - 46260734
Alignment:
18 aactccagggattgagattatcgcaattatcgaggatttcttggttgaagaatttcggtaaatcataaacgaaaattctaccggagctgcactcatcgtt 117  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
46260548 aactccagggattgagattatcgcaattatctaggatttcttggttgaagaatttcggtaaatcataaacgaaaattctaccggagctgcactcatcgct 46260647  T
118 gtttatagtgggaatagaatccaatacagtgtagttttgaattcttcttccaccatcaactacggcgagacgagtggggaagttgtg 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46260648 gtttatagtgggaatagaatccaatacagtgtagttttgaattcttcttccaccatcaactacggcgagacgagtggggaagttgtg 46260734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University