View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_23 (Length: 513)
Name: NF16561_high_23
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 76 - 494
Target Start/End: Original strand, 3186854 - 3187272
Alignment:
| Q |
76 |
gcattcagagagaaccatgcaacaaagaagatcctgcaaatcggagagagaatcagtcttaagagcgagacagagatcattgagctgtttacgacgccgt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3186854 |
gcattcagagagaaccatgcaacaaagaagatcctgcaaatcggagagagaatcagtcttaagagcgagacagagatcattgagctgtttacgacgccgt |
3186953 |
T |
 |
| Q |
176 |
tggtactcttccttgatccgtttcttctgctcacggtggttagtccatggccatctcatccgccattggagtgggacccacgataccttcatcaaccgag |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3186954 |
tggtactcttccttgatccgtttcttctgctcacggtggttagtccatggccatctcatccgccattggagtgggacccacgataccttcatcaaccgag |
3187053 |
T |
 |
| Q |
276 |
ctccttgttctctcatccatggctccactcggctctggataaactccatcgccgagagatttggatttacctaatttgagttattgttttggattcagaa |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3187054 |
ctccttgttctctcatccatggctccactcggctctggataaactccatcgccgagagatttggatttacttaatttgagttattgttttggattcagaa |
3187153 |
T |
 |
| Q |
376 |
attgaaatgaaaagttcaaagcaatgtaatgagaagaaaatgaattgtgtaggattacggttagatttggttttgaagaaacggttgagttgttttcgaa |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3187154 |
attgaaatgaaaagttcaaagcaatgtaatgagaagaaaatgaattgtgtaggattacggttagatttggttttgaagaaacggttgagttgttttcgaa |
3187253 |
T |
 |
| Q |
476 |
gtgatgaagaagaattctg |
494 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3187254 |
gtgatgaagaagaattctg |
3187272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University