View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_28 (Length: 498)
Name: NF16561_high_28
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 450; Significance: 0; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 450; E-Value: 0
Query Start/End: Original strand, 20 - 489
Target Start/End: Complemental strand, 27053875 - 27053406
Alignment:
| Q |
20 |
ttcatcctctccaaggcgtcaccacttagcgccaccgatgctgcagcttttgaaaagcacgctgccgccaacacattatccacaaagttgccggaattct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053875 |
ttcatcctctccaaggcgtcaccacttagcgccaccgatgctgcagcttttgaaaagcacgctgccgccaacacattatccacaaagttgccggaattct |
27053776 |
T |
|
| Q |
120 |
gctctgccgcacacctcttctgcttcccgaacataaatccacaactttgtcgtaaacccattctcagaggattaggaaccaacattttcaaaggatatgg |
219 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053775 |
gctctgccgcacatctcttctgcttcccgaacataaatccacaactttgtcgtaaacccgttctcagaggattaggaaccaacattttcaaaggatatgg |
27053676 |
T |
|
| Q |
220 |
taaaggagttgatttagataacaagtttagcttcgacaattacggttttactaaccctttcaaagattacgccaaaagaggtatttcattcggcatctac |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053675 |
taaaggagttgatttagataacaagtttagcttcgacaattacggttttactaaccctttcaaagattacgccaaaagaggtatttcattcggcatctac |
27053576 |
T |
|
| Q |
320 |
actaaatcttcttcaactaactccgttaccagtttggtggttgaaccaggtaagtttttccgcgaaacgatgttgaaggaagggactgttatgcctatgc |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27053575 |
actaaatcttcttcaactaactccgttaccagtttggtggttgaaccaggtaagtttttccgcgaaaggatgttgaaggaagggactgttatgcctatgc |
27053476 |
T |
|
| Q |
420 |
cagatataagggataagttaccacctaggtcgtttttgccccgttccattttgatcaaattgccctttgc |
489 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27053475 |
cagatacaagggataagttaccacctaggtcgtttttgccacgttccattttgatcaaattgccctttgc |
27053406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 357 - 489
Target Start/End: Complemental strand, 27065980 - 27065848
Alignment:
| Q |
357 |
tggttgaaccaggtaagtttttccgcgaaacgatgttgaaggaagggactgttatgcctatgccagatataagggataagttaccacctaggtcgttttt |
456 |
Q |
| |
|
||||| |||| |||||||||||||| || | |||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
27065980 |
tggttcaacctggtaagtttttccgggagaagatgttgaaggaagggacagttatgcctatgccagatataagggataaattaccgccaaggtcgttttt |
27065881 |
T |
|
| Q |
457 |
gccccgttccattttgatcaaattgccctttgc |
489 |
Q |
| |
|
||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
27065880 |
gcctcgttccattttgaccaaattgccatttgc |
27065848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 20 - 148
Target Start/End: Complemental strand, 27067064 - 27066936
Alignment:
| Q |
20 |
ttcatcctctccaaggcgtcaccacttagcgccaccgatgctgcagcttttgaaaagcacgctgccgccaacacattatccacaaagttgccggaattct |
119 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||| || || | || ||| ||||| |||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
27067064 |
ttcatcctctctaaggcctcaccactcagcgccaccgaagccgcgacattcacaaaacacgcggccgccaacacactctccacaaagctgccggaattct |
27066965 |
T |
|
| Q |
120 |
gctctgccgcacacctcttctgcttcccg |
148 |
Q |
| |
|
|||| ||||| || ||||||||||||||| |
|
|
| T |
27066964 |
gctccgccgcccatctcttctgcttcccg |
27066936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 358 - 489
Target Start/End: Complemental strand, 27079696 - 27079565
Alignment:
| Q |
358 |
ggttgaaccaggtaagtttttccgcgaaacgatgttgaaggaagggactgttatgcctatgccagatataagggataagttaccacctaggtcgtttttg |
457 |
Q |
| |
|
|||| |||| |||||||||||||| |||| ||||||||| ||||| |||||||||||||| ||||| | |||||| ||||| || ||||||||||| |
|
|
| T |
27079696 |
ggttcaacctggtaagtttttccgagaaaagatgttgaaacaaggggtggttatgcctatgccggatattaaggataaattaccgccaaggtcgttttta |
27079597 |
T |
|
| Q |
458 |
ccccgttccattttgatcaaattgccctttgc |
489 |
Q |
| |
|
|| ||| ||||||||| |||||| |||||||| |
|
|
| T |
27079596 |
ccacgtaccattttgaccaaattaccctttgc |
27079565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 32 - 123
Target Start/End: Complemental strand, 27080736 - 27080645
Alignment:
| Q |
32 |
aaggcgtcaccacttagcgccaccgatgctgcagcttttgaaaagcacgctgccgccaacacattatccacaaagttgccggaattctgctc |
123 |
Q |
| |
|
||||| |||||||| ||||||||||| | || ||||||| || ||||| || ||||||||| | ||||||||||||||||| |||||||| |
|
|
| T |
27080736 |
aaggcatcaccactcagcgccaccgagaccgcggcttttgcgaaacacgcggcagccaacacactctccacaaagttgccggagttctgctc |
27080645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University