View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_66 (Length: 362)
Name: NF16561_high_66
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 6e-96; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 166 - 347
Target Start/End: Complemental strand, 33645346 - 33645165
Alignment:
| Q |
166 |
cacttcatggtatgaagcagaacatatacccatgaaaatatgtttgtattttgcaggttgatgacaaccaatgagtaggtggcaacagatagatgattct |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33645346 |
cacttcatggtatgaagcagaacatatacccatgaaaatatgtttgtattttgcaggttgatgacaaacaatgagtaggtggcaacagatagatgattct |
33645247 |
T |
|
| Q |
266 |
tgttcaatttgttgagactcttcattaccttcttatctgtgaagtggttatggctgcggttgtggttctgcctcatcttcat |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33645246 |
tgttcaatttgttgagactcttcattaccttcttatctgtgaagtggttatggctgcggttgtggttctgcctcatcttcat |
33645165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 33056858 - 33056900
Alignment:
| Q |
167 |
acttcatggtatgaagcagaacatatacccatgaaaatatgtt |
209 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
33056858 |
acttcatggtatgaaacagaacatacacccatgaaaatatgtt |
33056900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 77
Target Start/End: Complemental strand, 33648549 - 33648495
Alignment:
| Q |
23 |
taggaatttgaggaattatggaaatgtcactttttagtaaatgaccaaatcatac |
77 |
Q |
| |
|
||||||| ||||||| | ||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
33648549 |
taggaatctgaggaagtgtggaaatgtcactttttggtacatgaccaaatcatac |
33648495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 33056908 - 33056959
Alignment:
| Q |
295 |
ttcttatctgtgaagtggttatggctgcggttgtggttctgcctcatcttca |
346 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||||| || |||||||||| |
|
|
| T |
33056908 |
ttcttatctgtgaagtagttatggttgcggttctggttgtgtctcatcttca |
33056959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University