View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_87 (Length: 303)
Name: NF16561_high_87
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_87 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 80644 - 80459
Alignment:
| Q |
24 |
gaggcttaaaattatgagtttttgctcggttaattttctgaatagtgtgtgaatctccctttggtttccttcttcatgacatgatttgcgacaaattttt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
80644 |
gaggcttaaaattatgagtttttgctcggctaattttctggatagtgtgtgaatctccctttggtttccttcttcatgacattatttgcgacaaattttt |
80545 |
T |
 |
| Q |
124 |
tggagcgtaactccacgatg--------atcatgcatctcccctcatctctgtttctggttagtggcgctataaatatgatatata |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
80544 |
tggagcgtaactccacgatgatcaattgatcatgcatctcccctcatctctgtttgtggttagtggcgctataaatatgatatata |
80459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 198 - 287
Target Start/End: Complemental strand, 80430 - 80341
Alignment:
| Q |
198 |
tatattttaactcagtatggaacatttgcgactcatatattgtgctagtgaccttgaaaaaatatcagctcctctcgcttggttgttcat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
80430 |
tatattttaactcagtatggaacatttgcgactcatatattgtgctagtgaccttgaaaaaacatcagctcctctcgcttggttgttcat |
80341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University