View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_high_99 (Length: 287)
Name: NF16561_high_99
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_high_99 |
 | |
|
| [»] scaffold1113 (2 HSPs) |
| | |
|
| [»] scaffold0961 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 9e-76; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 130 - 277
Target Start/End: Complemental strand, 32684226 - 32684079
Alignment:
| Q |
130 |
tagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctacaatttatcttcgaccaaatttgagat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684226 |
tagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctacaatttatcttcgaccaaatttgagat |
32684127 |
T |
|
| Q |
230 |
tcttacaatgatatccacacaccttcatgtcaaattcccctatctctg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32684126 |
tcttacaatgatatccacacaccttcatgtcaaatttccctatctctg |
32684079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 32684355 - 32684284
Alignment:
| Q |
1 |
gtcaacctcctctttatattcagccttggatttcagcgcacaattcaactgccagatctgctggtttagagg |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32684355 |
gtcaacctcctctttatattcagccttggatttcagcgcacaattcagctgccagatctgctggtttagagg |
32684284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 32692253 - 32692182
Alignment:
| Q |
1 |
gtcaacctcctctttatattcagccttggatttcagcgcacaattcaactgccagatctgctggtttagagg |
72 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
32692253 |
gtcaacctcctctttatattcaaccttgcatttcagcacacaattcagctgccagatctgctggtttagagg |
32692182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 130 - 164
Target Start/End: Complemental strand, 32692124 - 32692090
Alignment:
| Q |
130 |
tagaatcaaaattattgttagagaaaaacttgcct |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32692124 |
tagaatcaaaattattgttagagaaaaacttgcct |
32692090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 130 - 203
Target Start/End: Original strand, 61 - 134
Alignment:
| Q |
130 |
tagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
61 |
tagaatcaaaattattgttagagaaaaacttgcctcgaatgctaaatcagcatccggctcattcacgcgtctac |
134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 164
Target Start/End: Original strand, 1872 - 1904
Alignment:
| Q |
132 |
gaatcaaaattattgttagagaaaaacttgcct |
164 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1872 |
gaatcaaaatcattgttagagaaaaacttgcct |
1904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0961 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0961
Description:
Target: scaffold0961; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 164
Target Start/End: Complemental strand, 1745 - 1713
Alignment:
| Q |
132 |
gaatcaaaattattgttagagaaaaacttgcct |
164 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1745 |
gaatcaaaatcattgttagagaaaaacttgcct |
1713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University