View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_102 (Length: 292)
Name: NF16561_low_102
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_102 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 31 - 275
Target Start/End: Complemental strand, 36365789 - 36365546
Alignment:
| Q |
31 |
ctctaaaaattcaccaccttaactggtgaatattattattaaacgacatttnnnnnnnntcggagcaagtacatcaaatacctagcaagcatccgatann |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
36365789 |
ctctaaaaattcaccaccttaactggtgaatactattataaaacgacatttaaaaaaac-cggagcaagtacatcaaatacctagcaaatatccaatatt |
36365691 |
T |
 |
| Q |
131 |
nnnnnnnaatgacagataatccaaacatacacaactacgataaccatattcatacagttgcttatgcttgtagtgcttaagttacctttcaattttatga |
230 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36365690 |
tttatttaatgacagactatccaaacatacacaactacgataatcatattcatacagttgcttatgcttgtagtgcttaagttacctttcaattttatga |
36365591 |
T |
 |
| Q |
231 |
tgttgataccatttatgctgcgattgcaattttgactgttagtat |
275 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
36365590 |
tgttgataccatttatgttgcgattgcaattttgactattagtat |
36365546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University