View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_103 (Length: 291)
Name: NF16561_low_103
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 239
Target Start/End: Complemental strand, 2205659 - 2205612
Alignment:
| Q |
192 |
agaaaaaaccctgacacacttgacagcaccttgctttcacgagcttgt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2205659 |
agaaaaaaccctgacacacttgacagcaccttgctttcacgagcttgt |
2205612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 232 - 267
Target Start/End: Original strand, 15895292 - 15895327
Alignment:
| Q |
232 |
gagcttgtttttcttactttcttcatttagcaccca |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15895292 |
gagcttgtttttcttactttcttcatttagcaccca |
15895327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 232 - 267
Target Start/End: Complemental strand, 18861513 - 18861478
Alignment:
| Q |
232 |
gagcttgtttttcttactttcttcatttagcaccca |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
18861513 |
gagcttgtttttcttactttcttcatttagcaccca |
18861478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University