View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16561_low_105 (Length: 287)

Name: NF16561_low_105
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16561_low_105
NF16561_low_105
[»] chr1 (2 HSPs)
chr1 (19-131)||(1945586-1945698)
chr1 (187-272)||(1945436-1945522)


Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 1945698 - 1945586
Alignment:
19 gttctctgatgaaaaatgcaactacgcatttttatactcagtccttatgatcaaggtaattttatacgtaaaaaattctacaattttatactcagtcatg 118  Q
    ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1945698 gttctctgatgaaaaatgcaactacacaattttatactcagtccttatgatcaaggtaattttatacgtaaaaaattctacaattttatactcagtcatg 1945599  T
119 cggcttgaacatt 131  Q
    |||||||||||||    
1945598 cggcttgaacatt 1945586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 187 - 272
Target Start/End: Complemental strand, 1945522 - 1945436
Alignment:
187 ctatcatcgaaggttaatgaatactaatgattaaccagttttatggttaatt-aagttcgtaaatagcgctcactcacctgcctatg 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||| |||||||||||||||||||||    
1945522 ctatcatcgaaggttaatgaatactaatgattaaccagttttatggttaattaaagctcctaaatggcgctcactcacctgcctatg 1945436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University