View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_105 (Length: 287)
Name: NF16561_low_105
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_105 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 1945698 - 1945586
Alignment:
| Q |
19 |
gttctctgatgaaaaatgcaactacgcatttttatactcagtccttatgatcaaggtaattttatacgtaaaaaattctacaattttatactcagtcatg |
118 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1945698 |
gttctctgatgaaaaatgcaactacacaattttatactcagtccttatgatcaaggtaattttatacgtaaaaaattctacaattttatactcagtcatg |
1945599 |
T |
|
| Q |
119 |
cggcttgaacatt |
131 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1945598 |
cggcttgaacatt |
1945586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 187 - 272
Target Start/End: Complemental strand, 1945522 - 1945436
Alignment:
| Q |
187 |
ctatcatcgaaggttaatgaatactaatgattaaccagttttatggttaatt-aagttcgtaaatagcgctcactcacctgcctatg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||| ||||||||||||||||||||| |
|
|
| T |
1945522 |
ctatcatcgaaggttaatgaatactaatgattaaccagttttatggttaattaaagctcctaaatggcgctcactcacctgcctatg |
1945436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University