View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_108 (Length: 281)
Name: NF16561_low_108
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_108 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 5035151 - 5035063
Alignment:
| Q |
18 |
ttcaagaggtcaaagtggttggtggttgtgttgcacgatatgcgtatggtggtcctcttcctcctctacaatatcaatgagcttcaaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||| | ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5035151 |
ttcaagaggtcaaagtggttggtggtcgtgttgctcgatatgcgtttcgtggtcctcgtcctcctctacaatatcaatgagcttcaaga |
5035063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 174 - 246
Target Start/End: Complemental strand, 2490484 - 2490412
Alignment:
| Q |
174 |
atatgtattgggttagatatgatctatccaagtttgtgttatttagtttatttctcaatttgattataaagtt |
246 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2490484 |
atatgtattgggttagatattatttttccaagtttgacttatttattttatttctcaatttgattataaagtt |
2490412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 2525287 - 2525259
Alignment:
| Q |
18 |
ttcaagaggtcaaagtggttggtggttgt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2525287 |
ttcaagaggtcaaagtggttggtggttgt |
2525259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 2533845 - 2533805
Alignment:
| Q |
18 |
ttcaagaggtcaaagtggttggtggttgtgttgcacgatat |
58 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
2533845 |
ttcaagagctcaaagtggttggtggttgctttgcacgatat |
2533805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University