View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_111 (Length: 274)
Name: NF16561_low_111
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_111 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 6343237 - 6342997
Alignment:
| Q |
10 |
aatactaattaagtaaaaaagattataggactgccctaagcagaaagtaaattgtcccgcatgagaagcttttgtggttnnnnnnncataatctaatctt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6343237 |
aatactaattaagtaaaaaagattataggactgccctaagcagaaagtaaattgtcccgcatgagaagcttttgtggttaaaaaaacataatctaatctt |
6343138 |
T |
|
| Q |
110 |
ctaattaccgttgatgaaaggacaattgtttcttgaaggagccgttgttcaacagttgttgtctatattgatcataatatcatgtcatgctttgcaattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6343137 |
ctaattaccgttgatgaaaggacaattgtttcttgaaggagccgttgttcaacagttgttgtctatattgatcataatatcatgtcatgctttgcaattt |
6343038 |
T |
|
| Q |
210 |
gtaaaatcaagtgcttgtttttcacattctggttttcatct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6343037 |
gtaaaatcaagtgcttgtttttcacattctggttttcatct |
6342997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University