View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_125 (Length: 253)
Name: NF16561_low_125
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_125 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 32169455 - 32169215
Alignment:
| Q |
12 |
agcaaaggaccatgtgcaaaatatagtgactattgtgctgttttttgttcaaatactgggtttgctaggggtggcaagtgtaatgaagatggcgtgtgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169455 |
agcaaaggaccatgtgcaaaatatagtgactattgtgctgttttttgttcaaatactgggtttgctaggggtggcaagtgtaatgaagatggcgtgtgtt |
32169356 |
T |
|
| Q |
112 |
gttgccatgaataattgtatattctcagagtattgatacaaatctatctatacaagtaaactactcataataaaagatgttcatttataacatggatttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169355 |
gttgccatgaataattgtatattctcagagtattgatacaaatctatctatacaagt-aactactcataataaaagatgttcatttataacatggatttt |
32169257 |
T |
|
| Q |
212 |
acgactatttgaaatagaaacaatatatcttaataatttatt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169256 |
acgactatttgaaatagaaacaatatatcttaataatttatt |
32169215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University