View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_130 (Length: 251)
Name: NF16561_low_130
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_130 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 233
Target Start/End: Original strand, 33272294 - 33272522
Alignment:
| Q |
16 |
atgaaacaagactctttttgttattgaactacaacttcttgtgtggtcaattttatttttgactcatttgtcattgcatgttcttccccaagagtttcat |
115 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
33272294 |
atgaaacaaacctctttttgttattgaacaacaacttcttgtgtggtcaattttatttttgactcatttgtcattgcatgttcttgcccaagagttgcat |
33272393 |
T |
|
| Q |
116 |
taaatttattgcttctgtggttat------------ctaggaccaggctcagacatgacttgtcttcactcttgttctgtagtacaatcatatatctaac |
203 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33272394 |
taaatttattgcttctgtagttatctaagaccatacctaggaccaggctcagacatgacttgtcttcactcttgttctgtagtacaatcatatatctaac |
33272493 |
T |
|
| Q |
204 |
aaattttgacctcttcaatcatattctccc |
233 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
33272494 |
aaa-tttgacctcttcaatcatattctccc |
33272522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University