View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_139 (Length: 244)
Name: NF16561_low_139
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_139 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 27 - 243
Target Start/End: Complemental strand, 39919362 - 39919147
Alignment:
| Q |
27 |
tcttttatgattttcattttatttggaagaagtcttgttttgcattcttttcgttcaatgtgtgttagagaagatttggtgctctgaattctttattttg |
126 |
Q |
| |
|
|||| ||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39919362 |
tcttctatgattttcactttattttgaagaagttttgttttgcattcttttcgttcaatgtgtgttagagaagatttgatgctctgaattctttattttg |
39919263 |
T |
 |
| Q |
127 |
acaacctttccccatggccggaagtatagacttgnnnnnnnnncttttcttaacactccagctattaagagagaaaatattatgttaatccgaagttcga |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39919262 |
acaacctttccccatggccggaagtatagacct-tttttttttcttttcttaacactccagctattaagagggaaaatattatgttaatccgaagttcga |
39919164 |
T |
 |
| Q |
227 |
ctaaacggtaagtaaag |
243 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39919163 |
ctaaacggtaagtaaag |
39919147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University