View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_141 (Length: 244)
Name: NF16561_low_141
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_141 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 210
Target Start/End: Complemental strand, 39954238 - 39954044
Alignment:
| Q |
16 |
aatgtgacagcaattatcattaaaactgttaaaatccccatcatggccttattcccaagtggtaatccactgatgagaaccaacaccacacatagagaag |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39954238 |
aatgtgacagcaattatcattaaatctgttaaaatccccatcacggccttattcccaagtggaaatccactgatgagaaccaacaccacacatagagaag |
39954139 |
T |
 |
| Q |
116 |
caaagaaagacgtagagttgaaaaatataaatttcataacagctgcagtgcctgcttcacagaaatcataagtagtgcatgtatggttactgtgt |
210 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39954138 |
caaagaaagatgcagagttgaaaaatataaatttcataacagctgcagtgcctgcttcacagaaatcataagtagtgcatgtatggttactgtgt |
39954044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 204 - 244
Target Start/End: Complemental strand, 39949304 - 39949264
Alignment:
| Q |
204 |
actgtgttttgtatcttcttgccaaacaccgcctggtggac |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39949304 |
actgtgttttgtatcttcttgccaaacaccgcctggtggac |
39949264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 244
Target Start/End: Complemental strand, 39944951 - 39944919
Alignment:
| Q |
212 |
ttgtatcttcttgccaaacaccgcctggtggac |
244 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
39944951 |
ttgtatcttcttgccaaacaccgcccggtggac |
39944919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University