View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_150 (Length: 233)
Name: NF16561_low_150
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_150 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 38575307 - 38575111
Alignment:
| Q |
20 |
aacaaaagctacatgttaaacttcaacaaaatcaccgtgtcacaaaaatttcgccataacataaatacgaatttgctagagacacaaatgaatgagtatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38575307 |
aacaaaagctacatgttaaacttcaacaaaatcaccgtgtcacaaaaatttcgccataacataaatacgaatttgcaagagacacaaatgaatgagtatg |
38575208 |
T |
 |
| Q |
120 |
tgatgtaatgtgatgactcataagtttccaatattagagtgataattgaatgattgacctgatagaagtaaagtctacttgctaggccaccaacatc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38575207 |
tgatgtaatgtgatgactcataagtttccaatattagagtgataattgaatgattgacctgatagaagtaaagtctacttgctaggccaccaacatc |
38575111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University