View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16561_low_150 (Length: 233)

Name: NF16561_low_150
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16561_low_150
NF16561_low_150
[»] chr1 (1 HSPs)
chr1 (20-216)||(38575111-38575307)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 38575307 - 38575111
Alignment:
20 aacaaaagctacatgttaaacttcaacaaaatcaccgtgtcacaaaaatttcgccataacataaatacgaatttgctagagacacaaatgaatgagtatg 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
38575307 aacaaaagctacatgttaaacttcaacaaaatcaccgtgtcacaaaaatttcgccataacataaatacgaatttgcaagagacacaaatgaatgagtatg 38575208  T
120 tgatgtaatgtgatgactcataagtttccaatattagagtgataattgaatgattgacctgatagaagtaaagtctacttgctaggccaccaacatc 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38575207 tgatgtaatgtgatgactcataagtttccaatattagagtgataattgaatgattgacctgatagaagtaaagtctacttgctaggccaccaacatc 38575111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University