View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_159 (Length: 219)
Name: NF16561_low_159
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_159 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 42079681 - 42079463
Alignment:
| Q |
1 |
aatgaaataacgagagacgtgtgccgaatttaactcagttggtatagataattgtaaaatatacactgagacatgtgttcaaactttgaacttcccaatt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| || ||||||||| |||||||| || |||||| ||||||||||||| ||||||||| || |
|
|
| T |
42079681 |
aatgaaataacgagagacgtgtgtcgaatttaactcagttgatagagataattgcaaaatatataccgagacaggtgttcaaactttaaacttcccactt |
42079582 |
T |
 |
| Q |
101 |
attcacggtaagatgtgaattaacccactaaactatttagaaaggnnnnnnngaagaaaaagtaacatgagaagtaaagggtaacctgcaatggcaagtt |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42079581 |
attcacgataagatgtgaattaacccactaaactatttagaaaggaaaaaaagaagaaaaagtaacatgagaagtaaagggtaacctgcaatggcaagtt |
42079482 |
T |
 |
| Q |
201 |
tggattcatcatgatcctt |
219 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
42079481 |
tggattgatcatgatcctt |
42079463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 42071287 - 42071237
Alignment:
| Q |
169 |
gagaagtaaagggtaacctgcaatggcaagtttggattcatcatgatcctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42071287 |
gagaagtaaagggtaacctgcaatgggaagtttggattcatcatgatcctt |
42071237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 42055113 - 42055080
Alignment:
| Q |
180 |
ggtaacctgcaatggcaagtttggattcatcatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42055113 |
ggtaacctgcaatggcaagtttggattcatcatg |
42055080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University