View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_50 (Length: 405)
Name: NF16561_low_50
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 217 - 322
Target Start/End: Original strand, 33317922 - 33318029
Alignment:
| Q |
217 |
tcaactcttttacagataagatctgcaatgtagtct--gacatttctcgatatttgcttctttgtagcagcctgtaacgcatacaattatgaatgagcat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||| || || |||||||||||||||||||||||||||| || || ||||| |||| |
|
|
| T |
33317922 |
tcaactcttttacagataagatctgcaatgcagtctatgacatttctcaatgttagcttctttgtagcagcctgtaacgcataaaactaagaatgggcat |
33318021 |
T |
|
| Q |
315 |
gtagatga |
322 |
Q |
| |
|
|||||||| |
|
|
| T |
33318022 |
gtagatga |
33318029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University