View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_72 (Length: 356)
Name: NF16561_low_72
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 16 - 341
Target Start/End: Complemental strand, 32921745 - 32921419
Alignment:
| Q |
16 |
accctgatgtttgtttttggtcacactttgtacactgattttaaatgcttgtgtctgctagatgcaattcaattttgctttactatttctattggtttcc |
115 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32921745 |
accctgatttttgtttttggtcacactttgtacactgattttaaatgcttgtgcctgctagatgcaattcatttttgctttactatttctattggtttcc |
32921646 |
T |
 |
| Q |
116 |
atcgatgtatattgtcatccacgctactttttcatgcaccaacacttttaacatggtcatctctcagtgctattctttttcttagaagaatacataatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32921645 |
atcgatgtatattgtcatccacgctactttttcatgcaccaacacttttaacatggtcatctctcagtgctattctttttcttagaagaatacataatct |
32921546 |
T |
 |
| Q |
216 |
ttttctttgaggaatccatagaacaaacgatgatatatattctatattagaa-caattgtaccagtcaacttgcaatttcaatgatctttaggtattgga |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32921545 |
ttttctttgaggaatccatagaacaaacgatgatctatattctatattagaaccaattgtaccagtcaacttgcaatttcaatgatctttaggtattgga |
32921446 |
T |
 |
| Q |
315 |
ccatggttatcaaattgtagttcaaat |
341 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
32921445 |
ccatagttatcaaattgtagttcaaat |
32921419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University