View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_75 (Length: 350)
Name: NF16561_low_75
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 203 - 335
Target Start/End: Complemental strand, 14075425 - 14075293
Alignment:
| Q |
203 |
cgatcccatccgcccgtcaaagaaaagtaagatcaacggccaaagagcctccacgtggaaaaaccctagaaagcaatggcgaagatagcagcagagagag |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14075425 |
cgatcccatccgcccgtcaaagaaaagtaagatcaacggccaaagagcctccacgtggaaaaaccctagaaagcaatggcgaagatagcagcagagagag |
14075326 |
T |
 |
| Q |
303 |
cagttgctgccatgatgggtttgttgatggaga |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14075325 |
cagttgctgccatgatgggtttgttgatggaga |
14075293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 14 - 125
Target Start/End: Complemental strand, 14075617 - 14075506
Alignment:
| Q |
14 |
catcatcacggtcatctacatacacatgtgaacaccaaaacaatgaatcacaaaataaatcatcatcagatcgatcccgtccgtcgaatcaacaaacaca |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14075617 |
catcatcacggtcatctacatacacgtgtgaacaccaaaacaatgaatcacaaaataaatcatcatcagatcgatcccgtccgtcgaatcaacaaacaca |
14075518 |
T |
 |
| Q |
114 |
tcaacgacaagt |
125 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14075517 |
tcaacgacaagt |
14075506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University