View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_87 (Length: 321)
Name: NF16561_low_87
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 24 - 305
Target Start/End: Original strand, 38436420 - 38436715
Alignment:
| Q |
24 |
ctctttcatggtcttaaacataaacaaaaagacatgggggagtatattatttttcctttacaacatcgcctcttgtattaatgcatttgttttttggtat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38436420 |
ctctttcatggtcttaaacataaacaaaaagacatgggggagtatattatttttcctttacaacatcgcctcttgtattaatgcatttgttttttggtat |
38436519 |
T |
 |
| Q |
124 |
gcacattgttatccatgttttttcacaacttgtgtaataatttgatgatgtttgactaactttatggttcac--------------ttgcaatgtgctta |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38436520 |
gcacattgctatccatgttttttcacaacttgtgtaataatttgatgatgtttgactaactttatggttcacgatcgatataggttttgcaatgtgctta |
38436619 |
T |
 |
| Q |
210 |
aattttatcaaacatcaaattgagaggttttagtgaacttatgatgcatcgcctatatatgatttcactatctccttcttaacctccacttcacca |
305 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38436620 |
aattttatcaaacatcaaattgtgaggttttagtgaacttatgatgcatcgcctatatatgatttcactatctccttcttaacctccacttcacca |
38436715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University