View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_96 (Length: 298)
Name: NF16561_low_96
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_96 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 90 - 281
Target Start/End: Complemental strand, 24861097 - 24860900
Alignment:
| Q |
90 |
gttgttgttggtggggaggacctctgaggacaatctttgagagcgggtcttagggaccttaatctctcgagagtgtcattccttgtccttctgcaggatt |
189 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
24861097 |
gttgctgttggtggg-aggacctctaaggacaatctttgagagcgggtcttagggaccttaatttttcgagagtgtcattccttgtccttctgcaggatt |
24860999 |
T |
|
| Q |
190 |
gtgtaggccttgggcggtggctctgggatgcatggacaactttccactt-------acgtatgttctgatcttcgatgatgcggttctagacaacttga |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24860998 |
gtgtaggccttgggcggtggctctgggatgcatggacaactttccacttgctgaagacgtatgttctgatcttcgatgatgtggttctagacaacttga |
24860900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 24862437 - 24862370
Alignment:
| Q |
24 |
atagtcaaatttaggtaagggtataattgggaggagaaaagggaagttcaaaaccgtatactttctgt |
91 |
Q |
| |
|
|||||||||||||||||||||| | |||| |||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
24862437 |
atagtcaaatttaggtaagggtgtgattgtgaggagaaaaaggaagttcaaaacggtatactttctgt |
24862370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 63
Target Start/End: Original strand, 10214381 - 10214422
Alignment:
| Q |
22 |
ttatagtcaaatttaggtaagggtataattgggaggagaaaa |
63 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
10214381 |
ttatagtcaaatttatttaagggtataattggaaggagaaaa |
10214422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University