View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16561_low_97 (Length: 293)
Name: NF16561_low_97
Description: NF16561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16561_low_97 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 19 - 281
Target Start/End: Original strand, 13814352 - 13814609
Alignment:
| Q |
19 |
tataatatttgcaaattataagatacattaatatgcgttaaatatatcaaagaattct-atagatagggataaaggaagtaatttgtataggttaaggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
13814352 |
tataatatttgcaaattataagatacattaatatgcgttaaatatatcaaagaattcttatagatagggatgaaggaagtaatttgtatatgttaaggta |
13814451 |
T |
 |
| Q |
118 |
ttttgatttagggaaatgccaacaaatgctcttaaggcacttgataagaagtctnnnnnnnnnnnnnnntttatcttaaaaatgatacttttaacacctc |
217 |
Q |
| |
|
|||||||||||||||||||||| || | || ||| |||| |||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
13814452 |
ttttgatttagggaaatgccaataagtacttttagggcatttgataagaagtct------aaaaaaaactttatcttaaaaatgatacctttaacacctc |
13814545 |
T |
 |
| Q |
218 |
taaagtttcttttttagacttcttatcaaatacacttgttagaatttgagttgttttgcctttg |
281 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13814546 |
taaagtttctcttttggacttcttatcaaatacacttgttagaatttgaattgttttgcctttg |
13814609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University