View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16562_high_16 (Length: 257)
Name: NF16562_high_16
Description: NF16562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16562_high_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 6 - 257
Target Start/End: Original strand, 51678771 - 51679019
Alignment:
| Q |
6 |
aattagtaactctcgtatgctgggaaactgccaaataatttttgtaccggcaaataaatatctacaaattagattactacacaatattagatcttcattt |
105 |
Q |
| |
|
||||| ||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51678771 |
aattaataaatctcatatgctgggaaactgccaaataatttttgtaccggcaaat----atctacaaattagattactacacaatattagatcttcattt |
51678866 |
T |
 |
| Q |
106 |
taacagtatatttttgaattagttgtatgacaggtcgtgcactgcactggttgaatatgacgtgaacaatgtattatagag-gggtggcattcaatatct |
204 |
Q |
| |
|
||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
51678867 |
taatagtatatttttgaattaattgtatgacaggtcgtgcactgcactggttgaatatgacgtgaaccatgtattatagagagggtggcattcaatatct |
51678966 |
T |
 |
| Q |
205 |
gacccattttaggactcctttttcagaatatcagtttcactgccttctctgct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51678967 |
gacccattttaggactcctttttcagaatatcagtttcactgccttctctgct |
51679019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University