View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16562_low_13 (Length: 296)
Name: NF16562_low_13
Description: NF16562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16562_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 31 - 186
Target Start/End: Original strand, 11611905 - 11612061
Alignment:
| Q |
31 |
tattcaaactaaacaaggaccctcatccctagatnnnnnnnnn-ttatgcaatcttgataatgacttatgcaactgacacacacacatattaagaaagag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11611905 |
tattcaaactaaacaaggaccctcatccctagataaaaaaaaaattatgcaatcttgataatgacttatgcaactgacacacacacatattaagaaagag |
11612004 |
T |
|
| Q |
130 |
nnnnnnncagacactcacaacaaacatagcatagcaaaacactattcaacattcatg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612005 |
aaaaaaacagacactcacaacaaacatagcatagcaaaacactattcaacattcatg |
11612061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University