View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16562_low_16 (Length: 284)
Name: NF16562_low_16
Description: NF16562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16562_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 40518834 - 40518965
Alignment:
| Q |
18 |
catatttacttcctccaccaccgatgggttagatagttaattacttaccttatgctgaaattataattaggtatcaatcaataatttccatgttttctaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40518834 |
catatttacttcctccaccaccgatgggttagatagttaattacttaccttatgctgaaattataattaggtatcaatcaataacttccatgttttctaa |
40518933 |
T |
 |
| Q |
118 |
tctgtcaaaataataataataattatgttttgtat |
152 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
40518934 |
tctgtcaa---aataataataattatgttttgtat |
40518965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 236 - 277
Target Start/End: Original strand, 40518962 - 40519003
Alignment:
| Q |
236 |
gtatctgtgcttgtttacgtacttttattattgtagtattat |
277 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40518962 |
gtatctgtgcttgtttacgtacgtttattattgtagtattat |
40519003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University