View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16562_low_21 (Length: 253)
Name: NF16562_low_21
Description: NF16562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16562_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 969681 - 969618
Alignment:
| Q |
18 |
tctcaagcacaaagttttcttccttatagaacttttctcatggtgtgcttacttatataacaag |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
969681 |
tctcaagcacaaagttttcttccttatagaacttttctcatggtgtgcttacttatataacaag |
969618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 243
Target Start/End: Complemental strand, 969467 - 969428
Alignment:
| Q |
204 |
gatctagtagttaggtaggtagagcacatgcaccatataa |
243 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
969467 |
gatctagttgttaggtaggtagagcacatgcaccatataa |
969428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University