View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16562_low_26 (Length: 237)

Name: NF16562_low_26
Description: NF16562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16562_low_26
NF16562_low_26
[»] chr6 (2 HSPs)
chr6 (113-221)||(968809-968917)
chr6 (1-44)||(968988-969031)


Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 113 - 221
Target Start/End: Complemental strand, 968917 - 968809
Alignment:
113 tggaaatgataataggtgttggagggtttaaatagaaggagaattatatgatgtgttacttgtaataaagtacttctgtgagtgatatcaaaatgtttta 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
968917 tggaaatgataataggtgttggagggtttaaatagaaggagaattatatgatgtgttacttgtaataaagtacttctatgagtgatatcaaaatgtttta 968818  T
213 cgtacctaa 221  Q
    |||||||||    
968817 cgtacctaa 968809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 969031 - 968988
Alignment:
1 atcttgagatgagttgcatggttttttatccattatttttatat 44  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
969031 atcttgagatgagttgcatggttttttatccattatttttatat 968988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University