View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16562_low_26 (Length: 237)
Name: NF16562_low_26
Description: NF16562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16562_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 113 - 221
Target Start/End: Complemental strand, 968917 - 968809
Alignment:
| Q |
113 |
tggaaatgataataggtgttggagggtttaaatagaaggagaattatatgatgtgttacttgtaataaagtacttctgtgagtgatatcaaaatgtttta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
968917 |
tggaaatgataataggtgttggagggtttaaatagaaggagaattatatgatgtgttacttgtaataaagtacttctatgagtgatatcaaaatgtttta |
968818 |
T |
|
| Q |
213 |
cgtacctaa |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
968817 |
cgtacctaa |
968809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 969031 - 968988
Alignment:
| Q |
1 |
atcttgagatgagttgcatggttttttatccattatttttatat |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
969031 |
atcttgagatgagttgcatggttttttatccattatttttatat |
968988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University