View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16562_low_28 (Length: 227)
Name: NF16562_low_28
Description: NF16562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16562_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 19 - 136
Target Start/End: Original strand, 34771906 - 34772023
Alignment:
| Q |
19 |
atgagatgacctgcttgtgcaattataatgatggatggtgcttgtcttgcaaagaaaatcatgaaaagccaaaaaagtcatggcagcaagaagagaggga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771906 |
atgagatgacctgcttgtgcaattataatgatggatggtgcttgtcttgcaaagaaaatcatgaaaagccaaaaaagtcatggcagcaagaagagaggga |
34772005 |
T |
 |
| Q |
119 |
agctggtgatgaagtagc |
136 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34772006 |
agctggtgatgaagtagc |
34772023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University