View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16562_low_32 (Length: 211)
Name: NF16562_low_32
Description: NF16562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16562_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 97 - 192
Target Start/End: Original strand, 9394334 - 9394429
Alignment:
| Q |
97 |
tttcaacataattaaaatagaaacagaatttccaacatgcaataaaagaaataaacactaaaacccaattttcaacacgaaatcatatgaataaac |
192 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394334 |
tttcaacataaataaaatagaaacagaatttccaacatgcaataaaagaaataaacactaaaacccaattttcaacacgaaatcatatgaataaac |
9394429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 9394265 - 9394314
Alignment:
| Q |
16 |
atgaaccataaaacacagttttcaacatgaaattcaaaccaatgaaccat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394265 |
atgaaccataaaacacagttttcaacatgaaattcaaaccaatgaaccat |
9394314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University