View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16563_low_10 (Length: 295)
Name: NF16563_low_10
Description: NF16563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16563_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 246 - 283
Target Start/End: Complemental strand, 35019234 - 35019197
Alignment:
| Q |
246 |
attaattagcacctattcatcattgtattagttgccta |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35019234 |
attaattagcacctattcatcattgtattagttgccta |
35019197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University