View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16563_low_13 (Length: 239)
Name: NF16563_low_13
Description: NF16563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16563_low_13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 47538804 - 47538584
Alignment:
| Q |
19 |
ctagctttggtactttgttctttgggattaagtgaagggaataagattgaagagtgtaaagagatgattaggaaagttgatatggatggagatggtaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47538804 |
ctagctttggtactttgttctttgggattaagtgaagggaataagattgaagagtgtaaagagatgattaggaaagttgatatggatggagatggtaatg |
47538705 |
T |
|
| Q |
119 |
tcaattttaatgagttcaagagaatgatgaagaatgggggagcaaatctctttgccacataattcatttcaacctcaaccatccttacctcactatctat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47538704 |
tcaattttaatgagttcaagagaatgatgaagaatgggggagcaaatctctttgccacataattcatttcaacctctaccatccttacctcactatctat |
47538605 |
T |
|
| Q |
219 |
gataacaacttatccgaccct |
239 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
47538604 |
gataacaacttatccaaccct |
47538584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University