View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16563_low_7 (Length: 327)
Name: NF16563_low_7
Description: NF16563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16563_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 12 - 182
Target Start/End: Complemental strand, 43568120 - 43567950
Alignment:
| Q |
12 |
tgagatgaaaccagaacatagtggttattatgtgttgctgtcgaacatatatgcgcgtacaaacaagtggaaagatgctactgtcatgagaagattaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568120 |
tgagatgaaaccagaacatagtggttattatgcgttgctgtcgaacatatatgcgcgtacaaacaagtggaaagatgctactgtcatgagaagattaatg |
43568021 |
T |
 |
| Q |
112 |
aaggaaaaaggggttagaaaacaacctggatatagtctcattgagatagacggaaaaactcatgagtttac |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568020 |
aaggaaaaaggggttagaaaacaacctggatatagtctcattgagatagacggaaaaactcatgagtttac |
43567950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 259 - 308
Target Start/End: Complemental strand, 43567877 - 43567828
Alignment:
| Q |
259 |
gttagcagggtacatgggaaatactagtgaggcattgtttgacatagatg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43567877 |
gttagcagggtacatgggaaatactagtgaggcattgtttgacatagatg |
43567828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University