View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16563_low_9 (Length: 306)
Name: NF16563_low_9
Description: NF16563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16563_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 30000559 - 30000269
Alignment:
| Q |
1 |
attttattagctcgttcatggatcatttcaatgacaaaccatctcaaagtaaaattttgaactcaattgcggcctaacaagaattggtaatgggtcgaaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30000559 |
attttatcagctcgttcatggatcatttcaatgacaaaacatctcaaagtaaaattttgaactcaattgcggcctaacaagaattggtaataggtcgaaa |
30000460 |
T |
 |
| Q |
101 |
aacacgacctcttcccacaattttgcaaggacattttctagtacgcttgatgaattgtgaacaacaacactaatatacatagttatggaagaagtaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30000459 |
aacacgacctcttcccacaattttgcaaggacgttttctggtacgcttgatgaattgtgaacaacaacactaatatacatagttatggaagaagtaatga |
30000360 |
T |
 |
| Q |
201 |
ttgctaaaagaggaattacaaaatattccctaacaaatagctacaatgaaggcaaagacagaaggagggatcttttcggatgcatgaatct |
291 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30000359 |
ttgctaaaagaggaattacaaaagattccctaacaaatagctacaatgaaggcaaagacagaaggagggatcttttcggatgcatgaatct |
30000269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University