View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16565_high_8 (Length: 366)
Name: NF16565_high_8
Description: NF16565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16565_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 18167950 - 18167843
Alignment:
| Q |
119 |
tacttgaacaatcttttgggaggaaagaaacctatgaccaataaaagaagaatgaatgatgagtacaaccatgcgcactgaaaaatatttgatcatgtca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18167950 |
tacttgaacaatcttttgggaggaaagaaacctatgaccaataaaagaagaatgaatgatgagtacaaccatgcgcactgaaaaatatttgatcatggca |
18167851 |
T |
 |
| Q |
219 |
aactttat |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
18167850 |
aactttat |
18167843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 18168101 - 18167987
Alignment:
| Q |
1 |
ttataattcttaaatgttaatgccctaccaaaatttgatctggttgcgtcttataacaatgatcatgattccactttgaatcgatttttacttcaatgac |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18168101 |
ttatcattcttaaatgttaatgccctaccaaaatttgat-----tgcgtcttataacaatgatcatgattccactttgaatcgatttttacttcaacgac |
18168007 |
T |
 |
| Q |
101 |
ttgttgggttaggcacatta |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18168006 |
ttgttgggttaggcacatta |
18167987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University