View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16566_high_27 (Length: 365)
Name: NF16566_high_27
Description: NF16566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16566_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 47529868 - 47529722
Alignment:
| Q |
1 |
acagtatacataagaaacttctttaaatcagaattgtgtccctcacccttttgcttggcgatggtagtatttaacgctataattcaaactatgatgcaaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47529868 |
acagtatacaaaagaaacttctttaaatcagaattgtgtccctcacccttttgcttggagatggtagtatttaacgctataattcaaactatgatgcaaa |
47529769 |
T |
 |
| Q |
101 |
atgatgataagtagataacagcaaaaccatgaatgattatctatttg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47529768 |
atgatgataagtagataacagcaaaaccatgaatgattatctatttg |
47529722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 215 - 346
Target Start/End: Complemental strand, 47529654 - 47529523
Alignment:
| Q |
215 |
aattagaacatatcctaaagaaattatacaatcataaacatttttatgactgtcataaaactataactacagccacgcagtgtaaggccatttaggtttc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47529654 |
aattagaacatatcctaaagaaattatacaatcataaacatttttatgactgtcataaaactataactacagccacgcagtgtaaggccatttaggtttc |
47529555 |
T |
 |
| Q |
315 |
ttcagtggtttaaggcacatgacagtgtcctg |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47529554 |
ttcagtggtttaaggcacatgacagtgtcctg |
47529523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University