View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16566_high_33 (Length: 326)
Name: NF16566_high_33
Description: NF16566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16566_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 6700067 - 6700320
Alignment:
| Q |
18 |
agaatttgtagcttttgtcctctaaaattcattttaatcttaaatggaaaggatctttattccagttttcttgagcaatcaaaactattgtggactatgt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6700067 |
agaatttgtagcttttatcctctaaaattcattttaatcttaaatggagaggatctttattcctgttttcttgagcaatcaaaactattgtggactatgt |
6700166 |
T |
 |
| Q |
118 |
tctgcttgaaagnnnnnnnnctattacggggtgtgctattttttatttgactcaactattgtagacaacattagctattaattaacttgattgatccttt |
217 |
Q |
| |
|
||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6700167 |
tctacttgaaagaaaaaaaactattacgggctgtgctattttttatttgactcaactattgtagacaacattagctattaattaacttaattgatccttt |
6700266 |
T |
 |
| Q |
218 |
actttaattctatttttattaacacaaaattttaatcctattgattaatttccc |
271 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
6700267 |
actttaattctatttttattaatacaaaattttaatcctattgattaaattccc |
6700320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University