View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16566_low_38 (Length: 321)
Name: NF16566_low_38
Description: NF16566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16566_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 300
Target Start/End: Original strand, 36273454 - 36273736
Alignment:
| Q |
18 |
agattttagtccgaaaattcacaacaatatacgtgtataagtctatgcatgcaccggttcaatcacacaattttttaatcgatgacttatcttgtttcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36273454 |
agattttagtccgaaaattcacaacaatatacgtgtataagtctatgcatgcaccggttcaatcacacaattttttaatcgatgacttatcttgtttcct |
36273553 |
T |
 |
| Q |
118 |
tttgagtgtgatatatgcatgacacatccttttaatttagaccagttgattgatttcacatgctcgttgacgaaggttcaaatgctcataaatcaatgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36273554 |
tttgagtgtgatatatgcatgacacatccttttaatttagaccagttgattgatttcacatgctcgttgacgaaggttcaaatgctcataaatcaatgaa |
36273653 |
T |
 |
| Q |
218 |
tannnnnnnaatttatccgttggttattatccttgttttgacattcattcatgcatgcaagttctaagtaaatcgagaaatgt |
300 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36273654 |
tatttttttaatttatccgttggttattatccttgttttgacattcattcatgcatgcaagttctaagtaaatcgagaaatgt |
36273736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University